As most, but not all, marine cyanomyoviruses, have been found to contain the gene psbA, coding for the photosynthetic reaction centre protein D1 (Millard et al., 2004; Sullivan et al., 2006), it is possible that the presence of the psbA gene in the cyanophage genomes is associated with light-dependent phage adsorption. Alectinib concentration To establish whether this was the case, a set of degenerate PCR primers targeting the psbA gene was designed to amplify a 617-bp region and PCR products of the expected size were obtained from all the cyanophages used in this study (see Appendix S2). Subsequent

sequencing results of the PCR products confirmed that all the cyanophages carried the psbA gene, which indicates that the light-dependent cyanophage adsorption is not related to carriage of the psbA gene in cyanophage genomes. Sequence data have been deposited into the EMBL database with the following accession numbers: S-MM4 (FN773488), S-BP3 (FN773489), S-MM5 (FN773491), S-BM3 (FN773490), S-MM1 (FN773492), S-PWM1 (FN773493), S-PWM3 (FN773494) and S-BnM1 (FN773495). This paper represents the first step in the detailed characterization

of a phage–host system that has not been undertaken previously. This study has revealed a strong light dependence of adsorption of phage S-PM2 to Synechococcus sp. WH7803 cells, and the failure to adsorb in the dark was immediately reversed upon reillumination. The light-dependent adsorption did

not require continued photosynthetic activity by the host cells, or ATP generation, which agrees with the well-established 4-Aminobutyrate aminotransferase concept that the phage AC220 ic50 adsorption step does not require energy (Garen & Puck, 1951; Puck et al., 1951). Furthermore, adsorption was not influenced by the circadian rhythm of the host cells, and was not linked to carriage of the psbA gene in the phage genome. In comparison with 88% of marine cyanophage genomes carrying the psbA gene, only 50% contain the psbD gene coding for photosynthetic reaction centre protein D2 (Sullivan et al., 2006). Therefore, the possibility that the presence of the psbD gene is associated with light-dependent phage adsorption remains to be established. It would seem likely that light produces a conformational change in either the phage or the host that allows successful interaction between the phage adhesins or host receptors. The absence of a strong wavelength dependence of adsorption argues against the involvement of a particular chromophore in either the host or the phage. In the case of cyanophage AS-1 light-dependent adsorption was speculatively attributed to light-induced charge neutralization at the cell surface or light-induced changes in the ionic composition at the cell surface (Cseke & Farkas, 1979). There is a precedent for the environmental regulation of phage adsorption by myoviruses.

05). It was also Selleck Epigenetics Compound Library found that there was no significant difference in the ethylene evolution rate among the three different canola cultivars used: cv. Westar, cv. 4414RR and cv. Hyola 401 (data not shown). When canola hypocotyl segments were transformed and regenerated and then observed using a fluorescent microscope, faint green fluorescence was detected in the

transgenic calli and shoots (data not shown). Because the nontransformed control calli and shoots were also able to produce some background fluorescence, PCR with GFP-specific primers (eGFP-F, CATTTGGAGAGGACGTCGAG; eGFP-R, CTCAACACATGAGCGAAACC) were used to confirm that all transgenic plants contained the eGFP gene (data not shown). The transformation frequencies obtained for the three canola cultivars using different dilutions of A. tumefaciens YH-1 or YH-2 are shown in Table 2. Of the three dilutions used, when using organogenesis medium A (OA), for both strains YH-1 and YH-2, the cultivars Westar and 4414 RR showed the highest transformation frequency when using selleck screening library 1 × dilution (OD600 nm=1 culture suspension), while for Hyola 401, the optimal condition was 0.1 × dilution (OD600 nm=0.1 culture suspension). The presence of the ACC deaminase gene in strain YH-2 significantly increased the transformation frequency of all three cultivars when optimal dilutions were used (Table 2, gray highlighted rows). These results indicated that the commercial

cultivar 4414RR showed similar transformation efficiency as the model cultivar Westar, while the cultivar Hyola 401 showed a much lower transformation efficiency. This difference reflects the genotype dependence of A. tumefaciens-mediated transformation. Because during the ethylene evolution rates of the three canola cultivars are similar under the tested conditions, this genotype dependence is unlikely to be related to ethylene levels. These results are also consistent with and extend the findings obtained by Nonaka et al. (2008a) that ACC deaminase

can increase the gene delivery efficiency of A. tumefaciens to melon cotyledons, and suggest that ACC deaminase might be used as a general strategy to improve the A. tumefaciens-mediated transformation efficiency of many plants. It is well known that excluding the ethylene inhibitor AgNO3 from the organogenesis medium severely inhibits plant regeneration and thus the transformation efficiency (Eapen & George, 1997). To study whether the introduction of an acdS gene can replace the role of AgNO3, the transformation frequency was also compared for the two A. tumefaciens strains YH-1 and YH-2 using organogenesis medium B (OB) that did not contain AgNO3. Similar to the results obtained using OA medium (organogenesis medium with AgNO3), the presence of ACC deaminase in A. tumefaciens YH-2 increases the transformation frequency. For example, for the cultivar 4414RR, when transformed with a 1 × dilution of A.

coli FC40 system under carbon

starvation conditions and for the emergence of tetracycline-resistant mutants in response to antibiotic (tetracycline) treatment. NusA, a modulator of RNA polymerase, was previously shown to interact with Pol IV (Cohen et al., 2009). Hence, a model is proposed that DNA replication initiated during DSBR could generate DNA substrates that will stall RNA polymerase and lead to the recruitment of Pol IV by NusA (Cohen & Walker, 2010). The LexA regulon of P. aeruginosa and P. putida is significantly smaller than that of E. coli (Courcelle et al., 2001; Cirz et al., selleck screening library 2005; Abella et al., 2007). Among the specialized DNA polymerases, the transcription of the Pol II gene polB is not induced by DNA damage in these organisms. Although the Pol IV gene dinB promoter has a LexA-binding site and the level of transcription

from this promoter is slightly increased in Pseudomonas species in the presence of DNA-damaging agents (Tegova et al., 2004; Cirz et al., 2005; Abella et al., 2007), the extent of SOS induction is considerably smaller than that observed in E. coli. Compared with E. coli, pseudomonads seem to have evolved a regulatory system allowing a significantly high basal level of particular SOS regulon genes already in the absence of MAPK inhibitor DNA damage. Notably, the promoters of P. putida dinB gene and rulAB genes (encoding the Pol V homologue on toluene catabolic plasmid), both of which contain the LexA-binding site, are highly inducible by DNA damage PLEKHB2 in E. coli, whereas in P. putida, they express already at a considerably high basal level (Tegova et al., 2004; Tark et al., 2005). This indicates that the P. putida LexA repressor has evolved a lower affinity to its target sites compared with E. coli LexA. Importantly, the majority of bacteria, including pseudomonads, lack chromosomal Pol V genes umuD and umuC, but instead carry a

multiple gene cassette encoding a second copy of the α-subunit of DNA polymerase III and a protein related to Y-family DNA polymerases, DnaE2 and ImuB, respectively (Abella et al., 2004; Erill et al., 2006; Koorits et al., 2007). Similar to the Pol V genes, these genes are induced by DNA damage. In P. putida this gene cluster is negatively controlled by another LexA repressor, LexA2, which binds the DNA sequence GTACN4GTGC (Abella et al., 2004, 2007). The binding site of LexA2 differs completely from that recognized by E. coli-like LexA, which binds the classical CTGTN8ACAG box. Pseudomonas aeruginosa has only one LexA protein, which is related to E. coli LexA, and the imuB and dnaE2-containing gene cluster of P. aeruginosa is negatively controlled by this LexA (Cirz et al., 2005). The gene cluster similar to that identified in P. putida (Abella et al., 2004) or part of it has been identified in many families of Proteobacteria (Abella et al., 2004; Erill et al., 2006).

These findings also support the existing free-radical theory of aging, which states that organisms become older and become senescent because cells acquire free radical-induced damage over time (Harman, 1981; Ames et al., 1993; Beckman & Ames, 1998). As the process of PCD has been found to be evolutionarily conserved (Ameisen, 2002), revealing its mechanism in a bacterial system such as Xcg could be of great help

in deciphering the evolutionary linkage of this process. We thank Bhaskar Sanyal and Ashish Shrivastva for their help in performing ESR spectroscopy and HPLC analysis, respectively. “
“The chrysene-degrading bacterium Pseudoxanthomonas Volasertib purchase sp. PNK-04 was isolated from a coal sample. Three novel metabolites, hydroxyphenanthroic acid, 1-hydroxy-2-naphthoic acid and salicylic acid, were identified by TLC, HPLC and MS. Key enzyme activities, namely 1-hydroxy-2-naphthoate hydroxylase, 1,2-dihydroxynaphthalene dioxygenase, salicylaldehyde dehydrogenase and catechol-1,2-dioxygenase, were noted in the cell-free extract. These results suggest

that chrysene is catabolized via hydroxyphenanthroic acid, 1-hydroxy-2-naphthoic www.selleckchem.com/products/cx-5461.html acid, salicylic acid and catechol. The terminal aromatic metabolite, catechol, is then catabolized by catechol-1,2-dioxygenase to cis,cis-muconic acid, ultimately forming TCA cycle intermediates. Based on these studies, the proposed catabolic pathway for chrysene degradation by strain PNK-04 is chrysene hydroxyphenanthroic acid 1-hydroxy-2-naphthoic acid 1,2-dihydroxynaphthalene salicylic acid catechol cis,cis-muconic acid. Polycyclic aromatic hydrocarbons (PAHs) are compounds of environmental and health concern. Some PAHs and their biotransformation products have been shown to be toxic, mutagenic and carcinogenic to higher organisms and resistant to microbial degradation (Cerniglia, 1992; Kanaly & Harayama, 2000). Low-molecular-weight PAHs, composed of two or three aromatic rings, can be biodegraded under favourable medroxyprogesterone conditions; PAHs with four rings

or more are recalcitrant to biodegradation and may persist for long periods in the environment. Chrysene is a high-molecular-weight PAH consisting of four fused benzene rings. Among PAHs, it is classified as a priority pollutant by the US Environmental Protection Agency (Smith et al., 1989). The major goal of bioremediation is to transform organic pollutants into simple innocuous metabolites or mineralize them into carbon dioxide and water (Alexander, 1999). Microorganisms play an important role in the degradation of aromatic hydrocarbons in both terrestrial and aquatic systems. The use of microorganisms for bioremediation requires knowledge of the metabolic pathway of aromatic compounds in the organisms. However, successful bioremediation has been limited by the failure to remove high-molecular-weight PAHs (Wilson & Jones, 1993) such as chrysene. There are very few reports on the utilization of chrysene as a sole carbon source (Demane’che et al.

Notably, Yamada and colleagues used the system for both random integration of T-

(transferred) DNA and targeted insertion, for example disruption of the areA/nit-2 gene. As another alternative transformation technique, electroporation of germinated conidia was applied in T. rubrum, allowing the random integration of hph and eGFP (Dobrowolska & Staczek, 2009). Although not many comparative data on Enzalutamide manufacturer transformation efficiency are available – some species have not even been addressed at all – different dermatophyte species appear to be more or less amenable to DNA uptake and/or stable integration. Therefore, transformation protocols established for a selected species are not necessarily transferable to another, but require precise modifications. From our own work, we know for example that our standard PEG-protocol for the efficient transformation of A. benhamiae was not directly applicable for T. rubrum or M. canis.

The reasons for this observation are likely multifactorial, GSI-IX manufacturer including differential protoplast stability, cell wall composition, microconidia production, etc. Filamentous fungi are known to only poorly support site-directed insertion of linear DNA cassettes in the genome by homologous recombination, in contrast to yeasts such as Saccharomyces cerevisiae or the opportunistic pathogen C. albicans. Therefore, in filamentous fungi, identification of transformants with a desired genetic alteration has proven laborious in many cases. In order to circumvent this obstacle, parental strains were generated in diverse species that lack the nonhomologous end joining (NHEJ) recombination pathway, for example in N. crassa (Ninomiya et al., 2004), Aspergillus

spp. (da Silva Ferreira et al., 2006; Krappmann et al., 2006; Nayak et al., 2006), and since recently, also in T. mentagrophytes (Yamada et al., 2009a) and A. benhamiae aminophylline (Grumbt et al., 2011) (Table 1). Mutants deficient in NHEJ processes allow a strongly increased frequency of targeted insertions; however, an altered risk of unforeseen genetic variations cannot be excluded. In dermatophyte species, only a small number of genes have so far been analysed by targeted inactivation, for example pacC and MDR2 in T. rubrum (Fachin et al., 2006; Ferreira-Nozawa et al., 2006), Ku80, areA and Trim4 in T. mentagrophytes (Yamada et al., 2009a, b), areA in M. canis (Yamada et al., 2006) and Ku70 and AcuE in A. benhamiae (Grumbt et al., 2011). Interestingly, A. benhamiae has been shown in our work to allow efficient targeted gene deletion not only in a ku70 mutant background but also in the wild-type strain. This has been demonstrated by the construction of mutants in malate synthase AcuE, KU70 and other candidates (Grumbt et al., 2011; M. Grumbt and P. Staib, unpublished data). The use of two different dominant selection markers, hph and neo, even allowed for the first time the site-directed complementation of knockout mutant strains. Because the deletion of KU70 had no adverse effect on the virulence of A.