(2009), who demonstrated that H. pylori DNA has immunoregulatory properties, which may assist the organism with evading the immune mechanisms of the host. We would add two further hypotheses that may explain the apparent protective effect

of H. pylori. Firstly, infection with H. pylori and the development of antibodies against the organism Fostamatinib datasheet may confer an immunization-type protection against other pathogenic Helicobacter organisms. As we will describe, other pathogenic Helicobacter spp. may well be implicated in IBD; hence, this is a plausible hypothesis. [Indeed, variable disease phenotype during dual infection by different Helicobacter species has been described by Lemke et al. (2009) who demonstrated that Helicobacter bilis and H. pylori coinfection Buparlisib in vivo in mice attenuates H. pylori gastritis when compared with those infected with H. pylori as a single agent]. Secondly, the effect witnessed

may simply be due to other confounding variables such as the presence of an inherent genetic or environmental bias that favours H. pylori acquisition in some and the development of IBD in others. This would fit well with the observation that IBD is associated with increasing hygiene (Elliott et al., 2000), which in itself may be detrimental to H. pylori acquisition (Mendall et al., 1992). Further work is clearly required to determine whether the apparent protective effect of H. pylori is not simply confounding due to other variables, and if not, whether the effect is due to the presence

of the live bacterium or to an aspect of prior infection (such as seroconversion). Helicobacter organisms gained prominence as potential pathogens Baricitinib in IBD largely as a result of their strong association with a colitic disease in monkeys that has strong similarities to human UC. Cotton-top tamarin monkeys (Saguinus oedipus), native to Colombia, South America, were utilized in medical experimentation until their endangered status prevented their export for this purpose. Cotton-top tamarin colitis (CTTC) was described by Chalifoux & Bronson (1981) as a disease with parallels to human UC including a histological appearance containing crypt abscesses and a tendency towards progression to adenocarcinoma. This disease entity was further explored by Johnson et al. (1996), with the demonstration that higher incidence, recurrence and progression rates of the disease were seen in colony monkeys when compared with those raised in isolation. This suggested a pathogenic aetiology, but none was identified despite viral and bacterial culture. CTTC results in a diffuse colitis in affected monkeys. This was contrasted in the paper of Saunders et al. (1999) with human UC, which ‘involves the rectal area and progresses to proximal parts of the colon’.

It will also explore the role of pre-existing renal disease in causing preeclampsia and the potential for new biomarkers, both serum and urinary, to inform clinical practice with regard to differentiating preeclampsia from pre-existing renal disease. Recommendations about the future of women who have had preeclampsia

are unclear but the general consensus is that there are future cardiovascular risks, and to a lesser extent, future renal risks in these women. Regular review of proteinuria and glomerular filtration rate as well as overall cardiovascular risk status seems a logical step. Hypertension is the commonest medical complication in pregnancy and falls into four categories; gestational hypertension, preeclampsia, chronic hypertension (including VX-765 essential and secondary hypertension) and preeclampsia superimposed on chronic hypertension. Hypertension in pregnancy is defined as a blood pressure elevation greater than 140 mmHg systolic or

90 mmHg diastolic, which is confirmed with repeated measures over several hours. The hypertension of preeclampsia (de novo or superimposed) and gestational hypertension occurs after 20 weeks of gestation and resolves typically by 3 months post-partum.1 Chronic hypertension occurs when the blood pressure is elevated outside of these time constraints. Preeclampsia and superimposed preeclampsia, however, LY2157299 are multisystem disorders, and as Lenvatinib such are characterized by hypertension and evidence of involvement by one or more other organs.2 Other organ involvement commonly, but not always, involves the kidneys

and presents as proteinuria (>300 mg/24 h or spot urinary protein: creatinine ratio of ≥30 mg/mmol), elevated plasma creatinine >90 µmol/L or oliguria. Other organ involvement includes haematological changes (thrombocytopaenia, haemolysis, disseminated intravascular coagulation), liver disease (elevated serum transaminases, severe epigastric or right upper quadrant pain), neurological effects (convulsions, hyperreflexia, visual disturbances, stroke or headache), pulmonary oedema, foetal growth restriction or placental abruption. Maternal renal adaptation is characterized by an increase in glomerular filtration rate (GFR) to about 50% above pre-pregnancy states.3,4 An increase in renal plasma flow as well as an increase in the fractional excretion of urate is due to a decrease in renovascular resistance.5 The fractional excretion of sodium declines in pregnancy resulting in a net increase in total body water and sodium. These changes are initiated very early in pregnancy (prior to the first missed period) and are fully established by the end of the first trimester.3 They are maintained until the last 6 weeks prior to delivery when a reduction to pre-pregnancy creatinine clearance has been shown.

Improvement in degree of overhydration and anthropometric markers TSF, BSF and MAC in MHD patients was associated with survival. WU CHIA-CHAO1,3, SU SUI-LUNG2, KAO SEN-YEONG2, LU KUO-CHENG3, LIN YUH-FENG4 1Division of Nephrology, Department of Medicine, Tri-Service General Hospital, National Defense Medical Center; 2School of Public Health, National Defense Medical Center; 3Division of Nephrology, Department of Medicine, Cardinal

Tien Hospital, School of Medicine, Fu Jen Catholic University; 4Division of Nephrology, Department of Medicine, Shuang Ho Hospital, see more Graduate Institute of Clinical Medicine, Taipei Medical University Introduction: Taiwan has ABT 263 the highest prevalence and incidence of end stage renal disease in the world. The majorities were

due to diabetes mellitus (DM) or hypertension (HTN). However, the characteristic risk factors for the development of chronic kidney disease (CKD) in each specific high risk population in Taiwan region are still unclear. This study surveyed the most common risk factors and identified their effects on CKD in general population or patients with HTN and/or DM in Taiwan. Methods: This study included 5328 cases and 5135 controls in CKD/HTN/DM outpatient department and health center of 10 hospitals from 2008 to 2010. Forteen common risk factors were surveyed (4 of demographic factors, 5 of disease factors and 5 of lifestyle factors) and checked their impact on CKD development. Variables with significant heterogeneity between patients with different Phloretin comorbidities were stratified analysed.

Results: Male, aging, low incomes, hyperuricemia and no exercise habits were risk factors of CKD; and their impact on people with different comorbidities were the same. Anemia also was a risk factor, and there was an additive effect between anemia and hypertension on CKD. The association between hyperlipidemia related factors and CKD was moderated by HTN; it was a significant risk factor in people without HTN but not in patient with HTN. Based on the power of this study, we considered that hepatitis B, smoking, alcohol intake and groundwater using might not the important risk factors of CKD. The associations between hepatitis C/betelnut chewing and CKD were needed to further research. Conclusion: Several risk factors in each specific high risk population had been identified in Taiwan. We considered that screening/preventing strategy on CKD in high risk patients might differ from health population. Further larger studies are needed for more strong statistical power.

In this case, fetal ultrasonography at the 18th week of gestation led to a prenatal diagnosis of TD1 with characteristic bone features. The subject was stillborn at the 21st week of gestation, showing marked shortening of the long bones, small thorax and curved short femurs, but without a cloverleaf skull. The temporal lobe was enlarged and hyperconvoluted, appearing as

broad gyri and deep sulci, which were composed of focal polymicrogyria-like shallow sulci and heterotopic neuroblastic nests in the intermediate zone and marginal zone. Abundant precursor cells, immunoreactive for nestin and Ki-67 were observed with scattered mitoses in the thickened inner intermediate and subventricular zones of the temporal and occipital lobes. The cytoarchitecture from the entorhinal cortex to Ammon’s horn was Maraviroc in vivo disorganized with leptomeningeal glioneuronal heterotopia, immunoreactive for doublecortin and nestin. R788 molecular weight The expression of FGFR3 was virtually not discernible in the temporal and occipital

lobes or in the hippocampus. Genetic analysis revealed a point mutation at C8526T (R248C) in the exon 7 of FGFR3. This is the first report that demonstrates that overproduction of intermediate progenitor cells might be induced by FGFR3 mutation in a human TD1 case. “
“M. Jafari, V. Haist, W. Baumgärtner, S. Wagner, V. M. Stein, A. Tipold, H. Wendt and H. Potschka (2012) Neuropathology and Applied Neurobiology 38, 647–664 Impact of Theiler’s virus infection on hippocampal neuronal progenitor cells: differential effects in two mouse strains Aims: Disease-associated

alterations in hippocampal neurogenesis are discussed as an important factor contributing to long-term consequences of central nervous system diseases. Therefore, the study aimed to determine the impact of Theiler’s murine encephalomyelitis virus infection on hippocampal cell proliferation, neuronal progenitor cells and neurogenesis as well as the influence of microglia on respective disease-associated alterations. Methods: tuclazepam The impact of the infection was evaluated in two mouse strains which differ in the disease course, with an acute polioencephalitis followed by virus elimination in C57BL/6 mice and a chronic demyelinating disease in SJL/J mice. Results: Infection with the low neurovirulent BeAn strain did not exert significant acute effects regardless of the mouse strain. In the chronic phase, the number of neuronal progenitor cells and early postmitotic neurones was significantly reduced in infected SJL/J mice, whereas no long-term alterations were observed in C57BL/6 mice. A contrasting course of microglia activation was observed in the two mouse strains, with an early increase in the number of activated microglia cells in SJL/J mice and a delayed increase in C57BL/6 mice. Quantitative analysis did not confirm a correlation between the number of activated microglia and the number of neuronal progenitor cells and early postmitotic neurones.

This group traditionally has a lower graft survival and is considered high risk. There was no difference in patient or graft survival at 1 year between the two groups (70% graft survival in both). In the DST group, 30% of potential donors were not able to be used because of sensitisation. Immunosuppression was not given during the transfusion periods. Bordes-Aznar et al. did not clearly state sample size or immunosuppression regimen, and the randomization method was not

explained. In 2006, Marti et al.6 reported a prospective study of 61 potential allograft recipients (adults >16 years), both living related and unrelated, RG7204 supplier who received DSTs and compared them to carefully selected matched controls from the Collaborative Transplant Study Group (CTS). The controls were matched for age, sex, related vs unrelated, original disease, cold ischemia time, number of transplants, year of transplant, time on dialysis and HLA match. All patients were on cyclosporin and prednisone with 31/55

also receiving either azathioprine or mycophenolate. There was no significant difference in induction therapy between the DST and matched control group. Although there was a trend to better allograft survival in the DST group (98% vs. 82%) this failed to reach statistical significance and when examined on an intention-to-treat basis, the 6-year graft survival of the DST group was 88.5%. There were no statistically significant differences in 1-year serum creatinine or treated acute rejection rate between the two groups. Of concern was the fact that 10% of patients (n = 6) in the DST group developed positive T cell crossmatches following the transfusions and ABT-263 cost living donation did not proceed. This study was underpowered to look at graft survival differences and historical controls were

used. There were more pre-emptive transplants in the DST group (although time on dialysis was similar). Sonoda and Ishibashi7 retrospectively analyzed patients in the Japanese transplant registry. One HLA haplotype mismatch living related donor (LRD) patients (n = 1292) were analyzed in subgroups according to immunosuppression (cyclosporin n = 315; no cyclosporine n = 977) and DST transfusion (97/315 cyclosporin; 298/977 without cyclosporin). In the cyclosporin groups, the graft Molecular motor survival rate at 4 years for those with DST was 93.5%, compared with 76.2% for those with third-party transfusion (not DST) and 62.7% for those without transfusion. This improvement in graft survival was not seen in the non-cyclosporin group, where the 4-year graft survival for DST was 73.3%, 73.2% for third-party transfusion and 69.0% for those with no transfusion. Davies et al.8 prospectively (not randomized) compared three different protocols for DST: 1 multiple pre-transplant DST with azathioprine during the period and oral cyclosporin post-transplant (n = 34), All patients were LRD recipients with a 1 haplotype mismatch.

The regulation of p27Kip1 by n-butyrate occurs post-translationally via the suppression of Skp1–Cul1–F-box-protein (SCF) (skp2) ubiquitin ligase that targets p27Kip1 for destruction.40 In the anergy group, selleckchem p27Kip1 might have been already ubiquitinylated or degraded before the addition of n-butyrate. HDAC inhibitors are undergoing clinical trials as antitumour agents. Recent studies highlighted their anti-inflammatory effects through the modulation of dendritic cell function41 and regulatory T-cell numbers and function.42 This study focused on the anergic effects of the HDAC inhibitor n-butyrate on KLH-specific CD4+ T cells.

The results presented describe a mechanism by which p21Cip1 could maintain proliferative unresponsiveness

in anergic CD4+ T cells by interfering with the signalling pathways downstream of the T-cell receptor, particularly through the inhibition of MAPK and prevention of IL-2 synthesis. Aside from T-cell anergy induced by HDAC inhibitors, other anergy-inducing methods such as exposure to anti-CD3 antibody have been shown to up-regulate p21Cip1.43 The in vivo significance of p21Cip1 was underlined in studies RG7422 clinical trial showing that a peptidyl mimic of p21Cip1 inhibited T-cell proliferation and abrogated autoimmune disease development,44 while a p21Cip1 deficiency promoted autoimmune disease and enhanced the expansion of activated/memory T-cells.29,45 By describing an interaction between Org 27569 p21Cip1 and MAPK in anergic CD4+ T cells the results provide a mechanism by which p21Cip1 could maintain proliferative unresponsiveness and demonstrate cross-talk between two pathways that regulate the cell cycle in T cells; signalling cascades downstream of T-cell

receptor ligation and basic cell cycle machinery composed of cdk inhibitors. We would like to thank Annick DeLoose for her excellent technical assistance. This work was supported by the National Science Foundation, Arkansas Biosciences Institute and UAMS Graduate Student Research Funds. The authors have no conflict of interests. “
“Citation Chaouat G, Petitbarat M, Dubanchet S, Rahmati M, Ledée N. Tolerance to the Foetal Allograft? Am J Reprod Immunol 2010 In this review, we will detail the concept of tolerance and its history in reproductive immunology. We will then consider whether it applies to the foetal–maternal relationship and discuss the mechanisms involved in non-rejection of the foeto-placental unit. In June 1980, I attended the Gusberg Festschrift, organised by Norbert Gleicher, which resulted in the founding of AJRI and ASRI. The opening lecture by R.E. Billingham was entitled ‘Mechanisms or factors’ and proposed to explain exemption from rejection of the allogeneic foeto-placental unit. For this AJRI celebration issue, ASRI has requested a review on tolerance, a topic of great interest to me since 19741 and the Medawar paradigm.

S8), using Cell Quest software (BD PharMingen). For cytokine secretion analysis, cells were activated as described and the supernatants were assayed for IL-2 using ELISA (PeproTech, Rocky Hill, NJ, USA). All data were presented as average ± standard deviation (SD). Statistical significance was determined by Student’s t test; p < 0.05 was considered statistically significant. We gratefully acknowledge the support of the Society of Research Associates of the Lautenberg Center, the Concern Foundation of Los Angeles, and the Harold B. Abramson Chair in Immunology. This study

was supported by the US-Israel Binational Selleckchem Lapatinib Science Foundation (BSF), The Israel Sciences Foudation (ISF), The Israeli Ministry of Health, The Israel Cancer Research Foundation (ICRF), The Joint German-Israeli Research Program (DKFZ-MOST), and by The Joseph and Matilda Melnick Funds. We thank Prof. Muhlrad for the help with establishing the sedimentation assay, and Orly Perl for helping in performing the acceptor photobleaching FRET assay. The authors declare no financial or commercial Gefitinib supplier conflict of interest. As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer reviewed and may be re-organized for online delivery, but are not copy-edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed

to the authors. Figure S1. The putative actin-binding motifs within the ζ-chain. (A) A schematic representation of the full-length ζ structure (upper panel) and the position of the two positively charged clusters (indicated by ellipses drawn

on the sequence, Urease lower panel) located within the ζintracytoplasmic domain. (B) The ζ positively charged clusters are evolutionarily conserved between species; the basic residues are labeled in bold letters. (C) The proximal RRR motif was mutated to GGG and the distal motif to QQQ. Figure S2. Mutations in the ζ positively charged motifs disrupt its dicf localization. A chart demonstrating ζ dscf (Ds) and dicf (Di) ratios as measured by densitometry analysis. The values are avarage of three independent transfections of the WT, Distal, Proximal or double mutated ζ chains into COS cells. The cells were lysed, dicf and dscf were separated and subjected to immunoblotting with anti-ζ antibodies as described in Fig. 1C. *P<0.003, **p<0.00003 Figure S3. The ζ positively charged motifs mediate its direct binding to actin. Mutations of the positively charged ζ motifs prevent its binding to F-actin. (A) WT and MUT IC ζ proteins were used in a dot blot assay for testing their capacity to bind F-actin. Associated proteins were detected using anti-ζ antibodies. (B) Biotinylated peptides containing the ζ positively charged (pepR) or mutated (pepQ) motif, were used in a dot blot assay. A representative experiment is shown out of at least three performed. Figure S4.

Results:  We observed that S1P stimulates migration of HDMECs concomitant with upregulation of CTGF/CCN2 expression. Furthermore, the blockade of endogenous CTGF/CCN2 via siRNA abrogated S1P-induced HDMEC migration and capillary-like tube formation. Full-length CTGF induced cell migration and capillary-like tube formation with a potency similar to that of S1P, while C-terminal

domain of CTGF was slightly less effective. However, N-terminal domain had only a residual activity in inducing capillary-like tube formation. Conclusions:  This study revealed that CTGF/CCN2 is required for the S1P-induced endothelial cell migration, which suggests that CTGF/CCN2 may be an important mediator of S1P-induced physiological and pathological angiogenesis. Moreover, this study shows that the pro-migratory activity of CTGF/CCN2 is located in the C-terminal domain. “
“Please cite this paper as: Ritter, selleck Davidson, Henry, Davis-Gorman, Morrison, Frye, Cohen, Chandler, McDonagh and Funk (2011). Exaggerated Neutrophil-Mediated Reperfusion Injury after Ischemic Stroke in a Rodent Model of Type 2 Diabetes. Microcirculation 18(7), Alpelisib 552–561. Objective:  We tested the hypothesis that both chronic and acute inflammatory

processes contribute to worse reperfusion injury and stroke outcome in an experimental model of T2DM. Materials and Methods:  Twelve- to thirteen-week-old male Zucker Diabetic Fatty (ZDF) rats vs. Zucker Lean Controls (ZLC) rats were tested at baseline and after middle cerebral artery occlusion Fossariinae (ischemia) and reperfusion

(I–R). Neutrophil adhesion to the cerebral microcirculation, neutrophil expression of CD11b, infarction size, edema, neurologic function, sICAM, and cerebral expression of neutrophil–endothelial inflammatory genes were measured. Results:  At baseline, CD11b and sICAM were significantly increased in ZDF vs. ZLC animals (p < 0.05). After I–R, significantly more neutrophil adhesion and cell aggregates were observed in ZDF vs. ZLC (p < 0.05); infarction size, edema, and neurologic function were significantly worse in ZDF vs. ZLC (p < 0.05). CD11b and sICAM-1 remained significantly increased in ZDFs (p < 0.05), and cerebral expression of IL-1β, GRO/KC, E-selectin, and sICAM were significantly induced in ZDF, but not ZLC groups (p < 0.05) after 2.5 hours of reperfusion. Conclusion:  Both sides of the neutrophil–endothelial interface appear to be primed prior to I–R, and remain significantly more activated during I–R in an experimental model of T2DM. Consequently, reperfusion injury appears to play a significant role in poor stroke outcome in T2DM. "
“Please cite this paper as: Shi VY, Bao L, Chan LS. Inflammation-driven dermal lymphangiogenesis in atopic dermatitis is associated with CD11b+ macrophage recruitment and VEGF-C up-regulation in the IL-4-transgenic mouse model. Microcirculation 19: 567–579, 2012.

The primers for PCR were as follows: Fli-1 exon

IX/forward primer (positions 1156–1180), GACCAACGGGGAGTTCAAAATGACG; Fli-1 exon IX/reverse primer (positions 1441–1465), GGAGGATGGGTGAGACGGGACAAAG; and Pol II/reverse primer, GGAAGTAGCCGTTATTAGTGGAGAGG. buy MG-132 DNA was isolated from tail snips (4-week old mice) using a QIAamp Tissue kit (Qiagen, Santa Clarita, CA, USA). PCR conditions were one cycle at 94°C for 10 min followed by 35 cycles at 94°C for 1 min, 68°C for 1 min and 72°C for 1 min. A 309-base pairs (bp) fragment indicates the presence of the WT allele, and a 406-bp fragment is amplified from the mutated allele. BM cells were prepared for FISH using standard techniques. Briefly, cells were cultured overnight in Chang bone marrow culture (BMC) media (Irvine Scientific, Santa Ana, CA, USA), supplemented with penicillin and streptomycin. Then ethidium bromide (Sigma, St Louis, MO, USA) was added to the culture at a concentration of 10 µg/ml and the cells were incubated for 45 min. Next, colcemid (Invitrogen/Gibco, ICG-001 Grand Island, NY, USA) was

added to the culture at 0·1 µg/ml and incubated for an additional 40 min. Red blood cells were disrupted in hypotonic solution buffer (0·075 M KCl). Cells were then fixed in methanol acetic acid solution at the ratio of 5 : 2. Cells were suspended in fixation buffer at 1 × 107 cells/ml. A drop of each sample was placed on a microscope slide. After air-drying, slides were then dehydrated with ethanol. Next, slides were denatured at 65°C in denaturing solution [0·6× standard saline sodium citrate (SSC) and 70% formamide]. Slides were then quenched in 70% ice-cold ethanol and dehydrated again in ethanol. BM cells were then hybridized to Fenbendazole cyanine 3 (Cy3)-labelled mouse X-chromosome paint and fluorescein isothiocyanate (FITC)-labelled mouse Y-chromosome paint in hybridization solution (Cambio, Cambridge, UK) overnight

at 37°C. Slides were then washed in Stringency Wash solution (50% formamide and 0·5 × SSC) at 45°C for 5 min. After washing twice with SSC at 45°C, the slides were incubated with wash detergent solution (4 × SSC, 0·05% Tween-20) for 4 min at 45°C, and mounted with Gelmount (Biomedia, Foster City, CA, USA) containing 125 ng/ml 4,6-diamidino-2-phenylindole (DAPI; Invitrogen-Molecular Probes, Carlsbad, CA, USA). Finally, slides were examined using a Leica epifluorescent microscope with standard epifluorescence filters for FITC, Cy3 and DAPI (Leica, Bannockburn, IL, USA). Two hundred cells were counted from each sample. Mice were placed in metabolic cages for 24-h urine collection every 4 weeks, beginning at the 12 weeks of age after BM transplantation. Antibiotics (ampicillin and gentamicin from Invitrogen and chloramphenicol from Sigma) were added in collection tubes to inhibit bacterial growth. Urinary albumin excretion was determined by enzyme-linked immunosorbent assay (ELISA) as described previously [16].

These cells could, in turn, recruit neutrophils. Because livers of ALD patients, particularly those with AH, are infiltrated by IL-17+ cells [20], and because Th-17 cells play a role in neutrophil recruitment and express

CCR2 [22], we correlated CCL2 liver expression with IL-17+ cell infiltrates. We found that CCL2 liver expression was correlated with numbers of IL-17+ cells. Furthermore, IL-17+ cell infiltrates were correlated strongly with neutrophil infiltrates and with IL-8 liver expression. These results suggest that CCL2 plays a role in the pathogenesis of ALD by recruitment of Th17 cells which, in turn, would recruit neutrophils via an IL-8 effect. GSK126 mouse However, IL-17+ cell infiltrates may, in part, reflect neutrophil infiltrates. Indeed, we have shown previously, using confocal microscopy, that among liver-infiltrating IL-17+, T lymphocytes and neutrophils were represented most frequently [20]. As each AH episode is thought to be profibrogenic [4], we speculate that CCL2 secreted during the AH inflammatory burden

could enhance the fibrogenesis process. However, we found no difference in liver CCL2 expression between ALD patients with and without cirrhosis; nevertheless, this result should be viewed with caution, as non-cirrhotic patients in our cohort were scarce. We found no correlation between CCL2 liver expression and hepatic steatosis in our patient cohort, whereas CCL2 was involved in hepatic lipid metabolism in an experimental model of alcoholic liver disease APO866 clinical trial [16]. This relationship between CCL2 liver expression and steatosis may be present in the beginning of ALD, Nintedanib nmr but not in severe disease such as cirrhosis. Patients with the G-allele for −2518 A > G CCL2 polymorphism were present more frequently in the severely ill AH group than in other ALD patients. Moreover, among AH patients, the G-allele was more frequent in the severe form of the disease. It was shown previously

that the presence of the −2518 G-allele resulted in significantly greater CCL2 secretion than that found in patients with the A/A homozygous genotype in response to a given inflammatory stimulus [23], and this polymorphism has been implicated in numerous inflammatory diseases, including hepatitis C, acute pancreatitis, Crohn’s disease and, more recently, spontaneous bacterial peritonitis [24,25,28,29]. However, we did not find higher CCL2 plasma levels or liver expression in G-allele carriers in our cohort of patients (data not shown). It is possible that G-allele carriers are more likely to develop a severe form of AH, but that the levels of CCL2 at the time of alcoholic hepatitis are the same as in G-non-carriers. Our finding suggests that G-allele carriers are more likely to develop a severe form of AH than patients without the G-allele when exposed to alcohol.